Morpholino

MO1-bnc2

ID
ZDB-MRPHLNO-191004-3
Name
MO1-bnc2
Previous Names
None
Target
Sequence
5' - GAGCTTTCTCCTTCTTCTCCTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bnc2
Expressed Gene Anatomy Figures
pax2a Fig. 3 with image from Kolvenbach et al., 2019
Phenotype
Phenotype resulting from MO1-bnc2
Phenotype of all Fish created by or utilizing MO1-bnc2
Phenotype Fish Conditions Figures
pronephric duct apoptotic process increased occurrence, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
trunk curved, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
brain hydrocephalic, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
whole organism dead, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephric duct opening obstructed, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
cloaca apoptotic process increased occurrence, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
whole organism decreased life span, abnormal AB/TL + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephric duct increased width, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
pronephric glomerulus cystic, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
pronephric proximal convoluted tubule cystic, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephric duct opening obstructed, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephros cystic, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephric duct dilated, abnormal li1Tg + MO1-bnc2 standard conditions Fig. 3 with image from Kolvenbach et al., 2019
pronephric duct increased width, abnormal nkhgj4aEt + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
pronephric duct opening obstructed, abnormal nkhgj4aEt + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
pronephric duct dilated, abnormal nkhgj4aEt + MO1-bnc2 standard conditions Fig. 4 with image from Kolvenbach et al., 2019
Citations