Morpholino

MO2-pcdh10a

ID
ZDB-MRPHLNO-190909-1
Name
MO2-pcdh10a
Previous Names
  • E2I2 MO (1)
Target
Sequence
5' - AATAGGTGAGACGACTGATGACAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pcdh10a
Expressed Gene Anatomy Figures
pcdh8 Fig. S6 with image from Williams et al., 2018
pcdh10a Fig. S6 with image from Williams et al., 2018
pcdh10b Fig. 5 with image,  Fig. S6 with image from Williams et al., 2018
pcdh15a Fig. S6 with image from Williams et al., 2018
pcdh18b Fig. S6 with image from Williams et al., 2018
pcdh19 Fig. S6 with image from Williams et al., 2018
Phenotype
Phenotype resulting from MO2-pcdh10a
Phenotype Fish Figures
melanoblast mislocalised, abnormal vu234Tg; w47Tg + MO2-pcdh10a Fig. 4 with image from Williams et al., 2018
melanocyte mislocalised, abnormal WT + MO2-pcdh10a Fig. 3 with image from Williams et al., 2018
melanophore stripe morphology, abnormal WT + MO2-pcdh10a Fig. 3 with image from Williams et al., 2018
melanophore stripe melanocyte decreased amount, abnormal WT + MO2-pcdh10a Fig. 3 with image from Williams et al., 2018
migratory neural crest cell aggregated, abnormal vu234Tg; w47Tg + MO2-pcdh10a Fig. 4 with image from Williams et al., 2018
migratory neural crest cell mislocalised, abnormal vu234Tg; w47Tg + MO2-pcdh10a Fig. 4 with image from Williams et al., 2018
whole organism pcdh10b expression decreased amount, abnormal WT + MO2-pcdh10a Fig. S6 with image from Williams et al., 2018
whole organism pcdh18b expression decreased amount, abnormal WT + MO2-pcdh10a Fig. S6 with image from Williams et al., 2018
Phenotype of all Fish created by or utilizing MO2-pcdh10a
Phenotype Fish Conditions Figures
whole organism pcdh18b expression decreased amount, abnormal WT + MO2-pcdh10a standard conditions Fig. S6 with image from Williams et al., 2018
melanophore stripe morphology, abnormal WT + MO2-pcdh10a standard conditions Fig. 3 with image from Williams et al., 2018
melanocyte mislocalised, abnormal WT + MO2-pcdh10a standard conditions Fig. 3 with image from Williams et al., 2018
whole organism pcdh10b expression decreased amount, abnormal WT + MO2-pcdh10a standard conditions Fig. S6 with image from Williams et al., 2018
melanophore stripe melanocyte decreased amount, abnormal WT + MO2-pcdh10a standard conditions Fig. 3 with image from Williams et al., 2018
migratory neural crest cell mislocalised, abnormal vu234Tg; w47Tg + MO2-pcdh10a standard conditions Fig. 4 with image from Williams et al., 2018
melanoblast mislocalised, abnormal vu234Tg; w47Tg + MO2-pcdh10a standard conditions Fig. 4 with image from Williams et al., 2018
migratory neural crest cell aggregated, abnormal vu234Tg; w47Tg + MO2-pcdh10a standard conditions Fig. 4 with image from Williams et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.