Morpholino

MO2-ntrk2b

ID
ZDB-MRPHLNO-190716-1
Name
MO2-ntrk2b
Previous Names
None
Target
Sequence
5' - TTCCACGAACCCCTGCGGTCATAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ntrk2b
Expressed Gene Anatomy Figures
bdnf Fig. 2 with image from Sahu et al., 2019
ntrk2b Fig. 2 with image from Sahu et al., 2019
slc6a4a Fig. 5 with image from Sahu et al., 2019
th Fig. 3 with image,  Fig. 4 with image from Sahu et al., 2019
th2 Fig. 3 with image from Sahu et al., 2019
tph1a Fig. 5 with image from Sahu et al., 2019
tph1b Fig. 5 with image from Sahu et al., 2019
tph2 Fig. 5 with image from Sahu et al., 2019
Phenotype
Phenotype resulting from MO2-ntrk2b
Phenotype Fish Figures
caudal periventricular hypothalamus has fewer parts of type caudal periventricular hypothalamus serotonergic neuron, abnormal WT + MO2-ntrk2b Fig. 6 with image from Sahu et al., 2019
caudal tuberculum ventral region slc6a4a expression absent, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
diencephalon ventral region has fewer parts of type diencephalon dopaminergic neuron, abnormal WT + MO2-ntrk2b Fig. 4 with image from Sahu et al., 2019
paraventricular organ has fewer parts of type paraventricular organ serotonergic neuron, abnormal WT + MO2-ntrk2b Fig. 6 with image from Sahu et al., 2019
raphe nucleus tph2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
raphe nucleus slc6a4a expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
whole organism bdnf expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 2 with image from Sahu et al., 2019
whole organism th expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism th2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism ntrk2b expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 2 with image from Sahu et al., 2019
whole organism tph2 expression decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
whole organism dopamine decreased amount, abnormal WT + MO2-ntrk2b Fig. 3 with image from Sahu et al., 2019
whole organism serotonin decreased amount, abnormal WT + MO2-ntrk2b Fig. 5 with image from Sahu et al., 2019
Phenotype of all Fish created by or utilizing MO2-ntrk2b
Phenotype Fish Conditions Figures
whole organism th expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
whole organism tph2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
diencephalon ventral region has fewer parts of type diencephalon dopaminergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 4 with image from Sahu et al., 2019
caudal tuberculum ventral region slc6a4a expression absent, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
caudal periventricular hypothalamus has fewer parts of type caudal periventricular hypothalamus serotonergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 6 with image from Sahu et al., 2019
whole organism serotonin decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
whole organism th2 expression decreased amount, abnormal WT + MO2-ntrk2b control Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
diencephalon dopaminergic neuron th expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
whole organism dopamine decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 3 with image from Sahu et al., 2019
raphe nucleus slc6a4a expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
whole organism ntrk2b expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 2 with image from Sahu et al., 2019
whole organism bdnf expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 2 with image from Sahu et al., 2019
raphe nucleus tph2 expression decreased amount, abnormal WT + MO2-ntrk2b standard conditions Fig. 5 with image from Sahu et al., 2019
paraventricular organ has fewer parts of type paraventricular organ serotonergic neuron, abnormal WT + MO2-ntrk2b standard conditions Fig. 6 with image from Sahu et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.