Morpholino
MO3-erbb4a
- ID
- ZDB-MRPHLNO-190701-1
- Name
- MO3-erbb4a
- Previous Names
- None
- Target
- Sequence
-
5' - AGAAGGAAGCGAACCGGCCACATTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-erbb4a
No data available
Phenotype
Phenotype resulting from MO3-erbb4a
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO3-erbb4a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
muscle cell decreased diameter, abnormal | WT + MO3-erbb4a | control |
Fig. 3
from Paatero et al., 2018 |
thigmotaxis process quality, abnormal | WT + MO3-erbb4a | control |
Fig. 2
from Paatero et al., 2018 |
whole organism smyhc1 expression decreased amount, abnormal | WT + MO3-erbb4a | control |
Fig. 4
from Paatero et al., 2018 |
whole organism myl7 expression decreased amount, abnormal | WT + MO3-erbb4a | control |
Fig. 4
from Paatero et al., 2018 |
whole organism Ab1-erbb4 labeling decreased amount, abnormal | WT + MO3-erbb4a | control |
Fig. 2
from Paatero et al., 2018 |
1 - 5 of 10 Show all
Citations