Morpholino
MO1-uts2r3
- ID
- ZDB-MRPHLNO-190528-3
- Name
- MO1-uts2r3
- Previous Names
-
- uts2ra-1 (1)
- Target
- Sequence
-
5' - GTATATCCATTTGTCCTGGAGAGCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-uts2r3
No data available
Phenotype
Phenotype resulting from MO1-uts2r3
Phenotype | Fish | Figures |
---|---|---|
post-vent region curved ventral, abnormal | WT + MO1-uts2r3 |
Fig. 4
from Zhang et al., 2018 |
trunk curved ventral, abnormal | WT + MO1-uts2r3 |
Fig. 4
from Zhang et al., 2018 |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-uts2r3
1 - 4 of 4
Citations
- Wang, X., Wang, S., Meng, Z., Zhao, C. (2020) Adrb1 and Adrb2b are the major β-adrenergic receptors regulating body axis straightening in zebrafish. Journal of genetics and genomics = Yi chuan xue bao. 47(12):781-784
- Zhang, X., Jia, S., Chen, Z., Chong, Y.L., Xie, H., Feng, D., Wu, X., Song, D.Z., Roy, S., Zhao, C. (2018) Cilia-driven cerebrospinal fluid flow directs expression of urotensin neuropeptides to straighten the vertebrate body axis. Nature Genetics. 50(12):1666-1673
1 - 2 of 2
Show