Morpholino
MO3-ifnlr1
- ID
- ZDB-MRPHLNO-180913-1
- Name
- MO3-ifnlr1
- Previous Names
-
- ifnlr1-e4i4-MO (1)
- Target
- Sequence
-
5' - AGAGATGATACTAACCTGTGATCCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-ifnlr1
No data available
Phenotype
Phenotype resulting from MO3-ifnlr1
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO3-ifnlr1
1 - 5 of 15 Show all
Citations
- Wang, W.Q., Qiu, S.W., Huang, S.S., Wang, G.J., Han, M.Y., Kang, D.Y., Yuan, Y.Y., Gao, X., Dai, P. (2021) Transcriptome analysis of the early stage ifnlr1-mutant zebrafish indicates the immune response to auditory dysfunction. Gene expression patterns : GEP. 43:119229
- Gao, X., Yuan, Y.Y., Lin, Q.F., Xu, J.C., Wang, W.Q., Qiao, Y.H., Kang, D.Y., Bai, D., Xin, F., Huang, S.S., Qiu, S.W., Guan, L.P., Su, Y., Wang, G.J., Han, M.Y., Jiang, Y., Liu, H.K., Dai, P. (2018) Mutation of IFNLR1, an interferon lambda receptor 1, is associated with autosomal-dominant non-syndromic hearing loss.. Journal of Medical Genetics. 55(5):298-306
1 - 2 of 2
Show