Morpholino

MO2-tmem230a

ID

ZDB-MRPHLNO-180907-1

Name

MO2-tmem230a

Previous Names

None

Target

Sequence

5' - GTGTTGTTTCGGGTTGCCATCATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tmem230a

Expressed Gene	Anatomy	Figures
dll4	intersegmental vessel	Fig. 4 from Carra et al., 2018
efnb2a	blood vessel endothelium dorsal aorta	Fig. 4 from Carra et al., 2018
ephb4a	blood vessel endothelium caudal vein plexus	Fig. 4 from Carra et al., 2018
flt4	intersegmental vessel	Fig. 4 from Carra et al., 2018
kdrl	intersegmental vessel	Fig. 4 from Carra et al., 2018

Phenotype

Phenotype resulting from MO2-tmem230a

Phenotype	Fish	Figures
intersegmental vessel mCherry expression decreased amount, abnormal	jh11Tg; y1Tg + MO2-tmem230a	Fig. 6 from Carra et al., 2018
intersegmental vessel has extra parts of type endothelial cell, abnormal	y7Tg + MO2-tmem230a	Fig. 3 from Carra et al., 2018
intersegmental vessel flt4 expression increased amount, abnormal	AB + MO2-tmem230a	Fig. 4 from Carra et al., 2018
intersegmental vessel dll4 expression increased amount, abnormal	AB + MO2-tmem230a	Fig. 4 from Carra et al., 2018
intersegmental vessel kdrl expression increased amount, abnormal	AB + MO2-tmem230a	Fig. 4 from Carra et al., 2018
intersegmental vessel endothelial cell increased amount, abnormal	y7Tg + MO2-tmem230a	Fig. 3 from Carra et al., 2018

Phenotype of all Fish created by or utilizing MO2-tmem230a

Phenotype	Fish	Conditions	Figures
intersegmental vessel flt4 expression increased amount, abnormal	AB + MO2-tmem230a	standard conditions	Fig. 4 from Carra et al., 2018
intersegmental vessel kdrl expression increased amount, abnormal	AB + MO2-tmem230a	standard conditions	Fig. 4 from Carra et al., 2018
intersegmental vessel dll4 expression increased amount, abnormal	AB + MO2-tmem230a	standard conditions	Fig. 4 from Carra et al., 2018
intersegmental vessel endothelial cell increased amount, abnormal	y7Tg + MO2-tmem230a	standard conditions	Fig. 3 from Carra et al., 2018
intersegmental vessel has extra parts of type endothelial cell, abnormal	y7Tg + MO2-tmem230a	standard conditions	Fig. 3 from Carra et al., 2018
intersegmental vessel mCherry expression decreased amount, abnormal	jh11Tg; y1Tg + MO2-tmem230a	standard conditions	Fig. 6 from Carra et al., 2018
intersegmental vessel endothelial cell increased amount, abnormal	y7Tg + MO2-tmem230a + MO4-dll4	standard conditions	Fig. 5 from Carra et al., 2018
intersegmental vessel has extra parts of type endothelial cell, abnormal	y7Tg + MO2-tmem230a + MO4-dll4	standard conditions	Fig. 5 from Carra et al., 2018

Citations