Morpholino
MO1-atp7b
- ID
- ZDB-MRPHLNO-180710-1
- Name
- MO1-atp7b
- Previous Names
- None
- Target
- Sequence
-
5' - AATAAGTTGCCGTAACTCACAGGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-atp7b
No data available
Phenotype
Phenotype resulting from MO1-atp7b
| Phenotype | Fish | Figures |
|---|---|---|
| liver fabp10a expression absent, abnormal | WT + MO1-atp7b |
Fig. 3
from Reed et al., 2018 |
| liver decreased size, abnormal | WT + MO1-atp7b + MO9-tp53 |
Fig. 3
from Reed et al., 2018 |
Phenotype of all Fish created by or utilizing MO1-atp7b
Citations