Morpholino

MO2-wdr11

ID

ZDB-MRPHLNO-180628-2

Name

MO2-wdr11

Previous Names

exon 9–intron 9 (1)

Target

wdr11 (1)

Sequence

5' - TGGGTGGACGGCTATCTTACCAATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-wdr11

Expressed Gene	Anatomy	Figures
ptch2	head myotome	Fig. 4 from Kim et al., 2017

Phenotype

Phenotype resulting from MO2-wdr11

Phenotype	Fish	Figures
ceratobranchial cartilage mislocalised, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
ceratohyal cartilage mislocalised, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
cranial skeletal system development process quality, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
cranium decreased size, abnormal	AB/TL + MO2-wdr11	Fig. 4 , Fig. S5 from Kim et al., 2017
eye decreased size, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
head ptch2 expression decreased amount, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
head cartilage development disrupted, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
Meckel's cartilage decreased size, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
melanocyte migration disrupted, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
myotome ptch2 expression decreased amount, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
myotome development disrupted, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
neural crest cell migration disrupted, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
olfactory pit motile cilium absent, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
olfactory pit motile cilium decreased amount, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017
palatoquadrate cartilage decreased size, abnormal	AB/TL + MO2-wdr11	Fig. S5 from Kim et al., 2017
skeletal muscle refractivity, abnormal	AB/TL + MO2-wdr11	Fig. 4 from Kim et al., 2017

Phenotype of all Fish created by or utilizing MO2-wdr11

Phenotype	Fish	Conditions	Figures
myotome development disrupted, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
eye decreased size, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
cranium decreased size, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 , Fig. S5 from Kim et al., 2017
melanocyte migration disrupted, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
palatoquadrate cartilage decreased size, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
ceratohyal cartilage mislocalised, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
head cartilage development disrupted, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
cranial skeletal system development process quality, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
olfactory pit motile cilium absent, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
myotome ptch2 expression decreased amount, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
neural crest cell migration disrupted, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
head ptch2 expression decreased amount, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
Meckel's cartilage decreased size, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
ceratobranchial cartilage mislocalised, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. S5 from Kim et al., 2017
olfactory pit motile cilium decreased amount, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017
skeletal muscle refractivity, abnormal	AB/TL + MO2-wdr11	standard conditions	Fig. 4 from Kim et al., 2017

Citations