Morpholino
MO1-chp1
- ID
- ZDB-MRPHLNO-180611-1
- Name
- MO1-chp1
- Previous Names
- None
- Target
- Sequence
-
5' - CTGGAGCCCATGACTGCTGAAGATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chp1
No data available
Phenotype
Phenotype resulting from MO1-chp1
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-chp1
1 - 5 of 7 Show all
Citations
- Janzen, E., Mendoza-Ferreira, N., Hosseinibarkooie, S., Schneider, S., Hupperich, K., Tschanz, T., Grysko, V., Riessland, M., Hammerschmidt, M., Rigo, F., Bennett, C.F., Kye, M.J., Torres-Benito, L., Wirth, B. (2018) CHP1 reduction ameliorates spinal muscular atrophy pathology by restoring calcineurin activity and endocytosis. Brain : a journal of neurology. 141(8):2343-2361
- Mendoza-Ferreira, N., Coutelier, M., Janzen, E., Hosseinibarkooie, S., Löhr, H., Schneider, S., Milbradt, J., Karakaya, M., Riessland, M., Pichlo, C., Torres-Benito, L., Singleton, A., Zuchner, S., Brice, A., Durr, A., Hammerschmidt, M., Stevanin, G., Wirth, B. (2018) Biallelic CHP1 mutation causes human autosomal recessive ataxia by impairing NHE1 function. Neurology. Genetics. 4:e209
1 - 2 of 2
Show