Morpholino

MO1-e2f1

ID

ZDB-MRPHLNO-180531-4

Name

MO1-e2f1

Previous Names

None

Target

e2f1 (1)

Sequence

5' - TTTTAGTAATCATTCATACCTCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-e2f1

Expressed Gene	Anatomy	Figures
casp3a	whole organism	Fig. 5 from Zhang et al., 2017
cd247	whole organism	Fig. 5 from Zhang et al., 2017
e2f1	whole organism	Fig. 5 from Zhang et al., 2017
linc-tcrb	whole organism	Fig. 5 from Zhang et al., 2017
rag2	whole organism	Fig. 5 from Zhang et al., 2017
trac	whole organism	Fig. 5 from Zhang et al., 2017

Phenotype

Phenotype resulting from MO1-e2f1

Phenotype	Fish	Figures
thymus T cell increased amount, abnormal	zf411Tg + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism casp3a expression decreased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism e2f1 expression decreased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism trac expression increased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism linc-tcrb expression increased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism cd247 expression increased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017
whole organism rag2 expression increased amount, abnormal	AB + MO1-e2f1	Fig. 5 from Zhang et al., 2017

Phenotype of all Fish created by or utilizing MO1-e2f1

Phenotype	Fish	Conditions	Figures
whole organism casp3a expression decreased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism cd247 expression increased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism rag2 expression increased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism trac expression increased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism linc-tcrb expression increased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism e2f1 expression decreased amount, abnormal	AB + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
thymus T cell increased amount, abnormal	zf411Tg + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism casp3a expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism e2f1 expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism cd247 expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism linc-tcrb expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism rag2 expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
whole organism trac expression amount, ameliorated	rb1^sm11/sm11 + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
T cell apoptotic process occurrence, ameliorated	rb1^sm11/sm11; zf411Tg + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017
thymus T cell decreased amount, ameliorated	rb1^sm11/sm11; zf411Tg + MO1-e2f1	control	Fig. 5 from Zhang et al., 2017

Citations