Morpholino

MO1-kif20a

ID

ZDB-MRPHLNO-180305-8

Name

MO1-kif20a

Previous Names

None

Target

kif20a (1)

Sequence

5' - GCATGGAGACGCCAGAGCCATTATA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kif20a

Expressed Gene	Anatomy	Figures
kif20a	whole organism	Fig. 5 from Louw et al., 2018

Phenotype

Phenotype resulting from MO1-kif20a

Phenotype	Fish	Figures
atrium increased thickness, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
blood accumulation atrium, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
brain edematous, abnormal	s843Tg + MO1-kif20a	Fig. 5 , text only from Louw et al., 2018
bulbus arteriosus decreased size, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
cardiac ventricle increased thickness, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
heart decreased functionality, abnormal	WT + MO1-kif20a + MO4-tp53	Fig. 6 , text only from Louw et al., 2018
heart decreased size, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
heart contraction increased rate, abnormal	WT + MO1-kif20a	Fig. 6 from Louw et al., 2018
pericardium edematous, abnormal	s843Tg + MO1-kif20a	Fig. 5 , Fig. 6 , Fig. S5 , text only from Louw et al., 2018
trunk decreased length, abnormal	WT + MO1-kif20a	text only from Louw et al., 2018
whole organism kif20a expression decreased amount, abnormal	WT + MO1-kif20a	Fig. 5 from Louw et al., 2018
whole organism decreased length, abnormal	WT + MO1-kif20a	text only from Louw et al., 2018

Phenotype of all Fish created by or utilizing MO1-kif20a

Phenotype	Fish	Conditions	Figures
heart decreased size, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
cardiac ventricle increased thickness, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
blood accumulation atrium, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
trunk decreased length, abnormal	WT + MO1-kif20a	standard conditions	text only from Louw et al., 2018
atrium increased thickness, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
whole organism decreased length, abnormal	WT + MO1-kif20a	standard conditions	text only from Louw et al., 2018
heart contraction increased rate, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
pericardium edematous, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 , Fig. S5 , text only from Louw et al., 2018
bulbus arteriosus decreased size, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 from Louw et al., 2018
brain edematous, abnormal	WT + MO1-kif20a	standard conditions	text only from Louw et al., 2018
whole organism kif20a expression decreased amount, abnormal	WT + MO1-kif20a	standard conditions	Fig. 5 from Louw et al., 2018
heart decreased functionality, abnormal	WT + MO1-kif20a	standard conditions	Fig. 6 , text only from Louw et al., 2018
pericardium edematous, abnormal	WT + MO1-kif20a + MO4-tp53	standard conditions	text only from Louw et al., 2018
heart decreased functionality, abnormal	WT + MO1-kif20a + MO4-tp53	standard conditions	text only from Louw et al., 2018
pericardium edematous, abnormal	s843Tg + MO1-kif20a	standard conditions	Fig. 5 from Louw et al., 2018
brain edematous, abnormal	s843Tg + MO1-kif20a	standard conditions	Fig. 5 from Louw et al., 2018

Citations