Morpholino

MO1-tm4sf5

ID
ZDB-MRPHLNO-171108-1
Name
MO1-tm4sf5
Previous Names
None
Target
Sequence
5' - ACAGACTGGAAACTCACAAATAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tm4sf5
Expressed Gene Anatomy Figures
efnb2a Fig. 3 from Choi et al., 2014
itga5 Fig. 4 from Choi et al., 2014
myod1 Fig. 3 from Choi et al., 2014
tm4sf5 Fig. 2 from Choi et al., 2014
Phenotype
Phenotype resulting from MO1-tm4sf5
Phenotype Fish Figures
fast muscle cell ab-f310 labeling decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
fast muscle cell mislocalised, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
fast muscle cell morphology, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
head tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
head decreased size, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
muscle pioneer itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
muscle pioneer disorganized, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
muscle pioneer spatial pattern, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
pericardium edematous, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
pharyngeal arch 3-7 itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
skeletal muscle fiber development process quality, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell ab-f59 labeling decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell morphology, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell spatial pattern, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite fast muscle cell decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite slow muscle cell decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite border hypoplastic, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
somite border incomplete structure, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
trunk curved, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
trunk tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
whole organism decreased length, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
yolk syncytial layer itga5 expression mislocalised, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
Phenotype of all Fish created by or utilizing MO1-tm4sf5
Phenotype Fish Conditions Figures
muscle pioneer itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
somite fast muscle cell decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
trunk curved, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
pericardium edematous, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
skeletal muscle fiber development process quality, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
yolk syncytial layer itga5 expression mislocalised, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
somite border hypoplastic, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
head decreased size, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
slow muscle cell spatial pattern, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
fast muscle cell morphology, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
somite border incomplete structure, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
pharyngeal arch 3-7 itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
fast muscle cell ab-f310 labeling decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
somite slow muscle cell decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
slow muscle cell ab-f59 labeling decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
trunk tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
muscle pioneer disorganized, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
muscle pioneer spatial pattern, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
slow muscle cell morphology, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
whole organism decreased length, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
head tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
fast muscle cell mislocalised, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.