Morpholino

MO1-tm4sf5

ID
ZDB-MRPHLNO-171108-1
Name
MO1-tm4sf5
Previous Names
None
Target
Sequence
5' - ACAGACTGGAAACTCACAAATAGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tm4sf5
No data available
Phenotype
Phenotype resulting from MO1-tm4sf5
Phenotype Fish Figures
fast muscle cell ab-f310 labeling decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
fast muscle cell mislocalised, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
fast muscle cell morphology, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
head tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
head decreased size, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
muscle pioneer itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
muscle pioneer disorganized, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
muscle pioneer spatial pattern, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
pericardium edematous, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
pharyngeal arch 3-7 itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
skeletal muscle fiber development process quality, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell ab-f59 labeling decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell morphology, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
slow muscle cell spatial pattern, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite fast muscle cell decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite slow muscle cell decreased amount, abnormal WT + MO1-tm4sf5 Fig. 3 from Choi et al., 2014
somite border hypoplastic, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
somite border incomplete structure, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
trunk curved, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
trunk tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
whole organism decreased length, abnormal WT + MO1-tm4sf5 Fig. 2 from Choi et al., 2014
yolk syncytial layer itga5 expression mislocalised, abnormal WT + MO1-tm4sf5 Fig. 4 from Choi et al., 2014
Phenotype of all Fish created by or utilizing MO1-tm4sf5
Phenotype Fish Conditions Figures
muscle pioneer itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
somite fast muscle cell decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
trunk curved, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
pericardium edematous, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
skeletal muscle fiber development process quality, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
yolk syncytial layer itga5 expression mislocalised, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
somite border hypoplastic, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
head decreased size, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
slow muscle cell spatial pattern, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
fast muscle cell morphology, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
somite border incomplete structure, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
pharyngeal arch 3-7 itga5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 4 from Choi et al., 2014
fast muscle cell ab-f310 labeling decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
somite slow muscle cell decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
slow muscle cell ab-f59 labeling decreased amount, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
trunk tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
muscle pioneer disorganized, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
muscle pioneer spatial pattern, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
slow muscle cell morphology, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
whole organism decreased length, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
head tm4sf5 expression decreased distribution, abnormal WT + MO1-tm4sf5 standard conditions Fig. 2 from Choi et al., 2014
fast muscle cell mislocalised, abnormal WT + MO1-tm4sf5 standard conditions Fig. 3 from Choi et al., 2014
Citations