Morpholino
MO1-ccr2
- ID
- ZDB-MRPHLNO-171025-3
- Name
- MO1-ccr2
- Previous Names
-
- MO1-si:ch211-207g17.2
- Target
- Sequence
-
5' - AACTACTGTTTTGTGTCGCCGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccr2
No data available
Phenotype
Phenotype resulting from MO1-ccr2
No data available
Phenotype of all Fish created by or utilizing MO1-ccr2
1 - 5 of 5
Citations
- Sommer, F., Ortiz Zacarı As, N.V., Heitman, L.H., Meijer, A.H. (2020) Inhibition of macrophage migration in zebrafish larvae demonstrates in vivo efficacy of human CCR2 inhibitors. Developmental and comparative immunology. 116:103932
- Xie, Y., Tolmeijer, S., Oskam, J.M., Tonkens, T., Meijer, A.H., Schaaf, M.J.M. (2019) Glucocorticoids inhibit macrophage differentiation towards a pro-inflammatory phenotype upon wounding without affecting their migration. Disease models & mechanisms. 12(5):
- Cambier, C.J., O'Leary, S.M., O'Sullivan, M.P., Keane, J., Ramakrishnan, L. (2017) Phenolic Glycolipid Facilitates Mycobacterial Escape from Microbicidal Tissue-Resident Macrophages. Immunity. 47(3):552-565.e4
- Madigan, C.A., Cambier, C.J., Kelly-Scumpia, K.M., Scumpia, P.O., Cheng, T.Y., Zailaa, J., Bloom, B.R., Moody, D.B., Smale, S.T., Sagasti, A., Modlin, R.L., Ramakrishnan, L. (2017) A Macrophage Response to Mycobacterium leprae Phenolic Glycolipid Initiates Nerve Damage in Leprosy. Cell. 170:973-985.e10
- Cambier, C.J., Takaki, K.K., Larson, R.P., Hernandez, R.E., Tobin, D.M., Urdahl, K.B., Cosma, C.L., and Ramakrishnan, L. (2014) Mycobacteria manipulate macrophage recruitment through coordinated use of membrane lipids. Nature. 505(7482):218-222
1 - 5 of 5
Show