Morpholino

MO1-cyp2aa3,cyp2aa9

ID
ZDB-MRPHLNO-170920-1
Name
MO1-cyp2aa3,cyp2aa9
Previous Names
None
Targets
Sequence
5' - CTTCAGGAGAGCCGTAAACATGATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Although this morpholino does target both cyp2aa9 and cyp2aa3 the authors found that only cyp2aa9 mRNA was able to rescue the phenotype (Chen et al., 2016).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp2aa3,cyp2aa9
Expressed Gene Anatomy Figures
dab2 Fig. 2 with image from Chen et al., 2016
efnb2a Fig. 2 with image from Chen et al., 2016
etsrp Fig. 2 with image from Chen et al., 2016
flt1 Fig. 2 with image from Chen et al., 2016
flt4 Fig. 2 with image from Chen et al., 2016
gata1a Fig. 2 with image from Chen et al., 2016
myb Fig. 1 with image,  Fig. 5 with image from Chen et al., 2016
rag1 Fig. 1 with image from Chen et al., 2016
runx1 Fig. 1 with image from Chen et al., 2016
shha Fig. 2 with image from Chen et al., 2016
tal1 Fig. 2 with image from Chen et al., 2016
Phenotype
Phenotype resulting from MO1-cyp2aa3,cyp2aa9
No data available
Phenotype of all Fish created by or utilizing MO1-cyp2aa3,cyp2aa9
Phenotype Fish Conditions Figures
hematopoietic stem cell differentiation process quality, ameliorated WT + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: forskolin Fig. 5 with image from Chen et al., 2016
dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 5 with image from Chen et al., 2016
hematopoietic stem cell differentiation disrupted, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 5 with image from Chen et al., 2016
prostaglandin-E synthase activity disrupted, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 5 with image from Chen et al., 2016
ventral wall of dorsal aorta apoptotic process increased occurrence, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 4 with image from Chen et al., 2016
hematopoietic stem cell myb expression amount, ameliorated WT + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: forskolin Fig. 5 with image from Chen et al., 2016
ventral wall of dorsal aorta apoptotic process process quality, ameliorated WT + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 4 with image from Chen et al., 2016
ventral wall of dorsal aorta cell population proliferation decreased occurrence, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 4 with image from Chen et al., 2016
ventral wall of dorsal aorta cell population proliferation process quality, ameliorated WT + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 4 with image from Chen et al., 2016
thymus rag1 expression decreased amount, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
whole organism prostaglandin E2 decreased amount, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 5 with image from Chen et al., 2016
dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
post-vent region hematopoietic stem cell absent, abnormal la2Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
post-vent region EGFP expression absent, abnormal la2Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
ventral wall of dorsal aorta GFP expression decreased amount, abnormal w25Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 3 with image from Chen et al., 2016
canonical Wnt signaling pathway process quality, ameliorated w25Tg + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 3 with image from Chen et al., 2016
canonical Wnt signaling pathway disrupted, abnormal w25Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 3 with image from Chen et al., 2016
ventral wall of dorsal aorta GFP expression amount, ameliorated w25Tg + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 3 with image from Chen et al., 2016
ventral wall of dorsal aorta EGFP expression decreased amount, abnormal zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 3 with image from Chen et al., 2016
post-vent region hematopoietic stem cell decreased amount, abnormal zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
post-vent region EGFP expression decreased amount, abnormal zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
hematopoietic stem cell differentiation disrupted, abnormal zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 3 with image from Chen et al., 2016
hematopoietic stem cell EGFP expression amount, ameliorated zf169Tg + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 3 with image from Chen et al., 2016
hematopoietic stem cell EGFP expression decreased amount, abnormal zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 3 with image from Chen et al., 2016
hematopoietic stem cell differentiation process quality, ameliorated zf169Tg + MO1-cyp2aa3,cyp2aa9 chemical treatment by environment: prostaglandin E2 Fig. 3 with image from Chen et al., 2016
dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-cyp2aa3,cyp2aa9 standard conditions Fig. 1 with image from Chen et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.