Morpholino

MO8-lbx2

ID

ZDB-MRPHLNO-170919-3

Name

MO8-lbx2

Previous Names

None

Target

lbx2 (1)

Sequence

5' - CGAACAGAAGTCACCTAGCTCGCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

There is a mismatch in this morpholino sequence. This MO was designed for the TU wild type line.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO8-lbx2

No data available

Phenotype

Phenotype resulting from MO8-lbx2

No data available

Phenotype of all Fish created by or utilizing MO8-lbx2

Phenotype	Fish	Conditions	Figures
axial mesoderm chrd expression increased amount, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1, Fig. 5 from Lu et al., 2014
trunk ventral region absent, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	control	Fig. 2 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1, Fig. 5 from Lu et al., 2014
trunk posterior region absent, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
margin ventral region eve1 expression decreased distribution, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal	AB/TU + MO4-tp53 + MO5-lbx2 + MO8-lbx2	standard conditions	Fig. 1 from Lu et al., 2014

Citations