Morpholino
MO1-svep1
- ID
- ZDB-MRPHLNO-170630-1
- Name
- MO1-svep1
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - ATTACACAGCTGCTCTTACCGCTGC - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            Splice-blocking MO.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO1-svep1
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO1-svep1
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    1 - 3 of 3
    
                
                    
                        Phenotype of all Fish created by or utilizing MO1-svep1
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    1 - 5 of 5
    
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            - Coxam, B., Collins, R.T., Hußmann, M., Huisman, Y., Meier, K., Jung, S., Bartels-Klein, E., Szymborska, A., Finotto, L., Helker, C.S.M., Stainier, D.Y.R., Schulte-Merker, S., Gerhardt, H. (2022) Svep1 stabilizes developmental vascular anastomosis in reduced flow conditions. Development (Cambridge, England). 149(6):
- Morooka, N., Futaki, S., Sato-Nishiuchi, R., Nishino, M., Totani, Y., Shimono, C., Nakano, I., Nakajima, H., Mochizuki, N., Sekiguchi, K. (2017) Polydom Is an Extracellular Matrix Protein Involved in Lymphatic Vessel Remodeling. Circulation research. 120:1276-1288
1 - 2 of 2
Show
