Morpholino
MO1-tomm70a
- ID
- ZDB-MRPHLNO-170417-1
- Name
- MO1-tomm70a
- Previous Names
- None
- Target
- Sequence
-
5' - CTACGGGCTTCGATGCAGCCATCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tomm70a
No data available
Phenotype
Phenotype resulting from MO1-tomm70a
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-tomm70a
1 - 5 of 11 Show all
Citations
- Shi, D., Qi, M., Zhou, L., Li, X., Ni, L., Li, C., Yuan, T., Wang, Y., Chen, Y., Hu, C., Liang, D., Li, L., Liu, Y., Li, J., Chen, Y.H. (2018) Endothelial Mitochondrial Preprotein Translocase Tomm7-Rac1 Signaling Axis Dominates Cerebrovascular Network Homeostasis. Arteriosclerosis, Thrombosis, and Vascular Biology. 38:2665-2677
- Li, J., Qi, M., Li, C., Shi, D., Zhang, D., Xie, D., Yuan, T., Feng, J., Liu, Y., Liang, D., Xu, X., Chen, J., Xu, L., Zhang, H., Ye, J., Lv, F., Huang, J., Peng, L., Chen, Y.H. (2014) Tom70 serves as a molecular switch to determine pathological cardiac hypertrophy. Cell Research. 24:977-93
1 - 2 of 2
Show