Morpholino

MO1-rbm7

ID
ZDB-MRPHLNO-170127-5
Name
MO1-rbm7
Previous Names
None
Target
Sequence
5' - ATGGCCCAGCCTAGTGGAAAAAGAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbm7
No data available
Phenotype
Phenotype resulting from MO1-rbm7
Phenotype of all Fish created by or utilizing MO1-rbm7
Phenotype Fish Conditions Figures
axonogenesis disrupted, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
cerebellum structure, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
hindbrain morphogenesis disrupted, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
motor neuron axon branchiness, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
cerebellum Purkinje cell distributed, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
hindbrain morphology, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
motor neuron axon truncated, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
cerebellar Purkinje cell layer structural organization disrupted, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 5 with image from Giunta et al., 2016
motor nucleus of vagal nerve shortened, abnormal rw0Tg + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism atxn1b expression increased amount, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 6 from Giunta et al., 2016
whole organism deformed, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
brain edematous, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
head swollen, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
eye decreased size, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism decreased length, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
thigmotaxis disrupted, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. text from Giunta et al., 2016
heart edematous, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
embryo development delayed, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism dead, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
whole organism decreased life span, abnormal slc24a5unspecified/unspecified + MO1-rbm7 standard conditions Fig. 4 with image from Giunta et al., 2016
Citations