Morpholino

MO1-mir29b-1

ID
ZDB-MRPHLNO-170110-1
Name
MO1-mir29b-1
Previous Names
None
Target
Sequence
5' - ACACTGATTTCAAATGGTGCTAGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mir29b-1
No data available
Phenotype
Phenotype resulting from MO1-mir29b-1
No data available
Phenotype of all Fish created by or utilizing MO1-mir29b-1
No data available
Citations