Morpholino

MO3-rel

ID
ZDB-MRPHLNO-161206-5
Name
MO3-rel
Previous Names
  • translation initiation site (1)
Target
Sequence
5' - TTGAGAGGGATTGCACATCCATAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-rel
No data available
Phenotype
Phenotype resulting from MO3-rel
Phenotype Fish Figures
blastoderm dorsal region d2EGFP expression decreased amount, abnormal zf4368Tg/zf4368Tg + MO3-rel Fig. 2 with image from Zou et al., 2023
blastoderm dorsal region dharma expression increased distribution, abnormal AB + MO3-rel Fig. 2 with image,  Fig. 4 with image from Zou et al., 2023
blastoderm dorsal region chrd expression increased distribution, abnormal AB + MO3-rel Fig. 2 with image,  Fig. 4 with image from Zou et al., 2023
blastoderm ventral region ventx expression decreased distribution, abnormal zf4368Tg/zf4368Tg + MO3-rel Fig. 2 with image from Zou et al., 2023
blastodisc axin2 expression increased amount, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
blastodisc sp5l expression increased amount, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
blastodisc sp5l expression increased distribution, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
blastodisc axin2 expression increased distribution, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
blastodisc dorsal side frzb expression decreased distribution, abnormal AB + MO3-rel Fig. 4 with image from Zou et al., 2023
dorsal/ventral pattern formation decreased process quality, abnormal AB + MO3-rel Fig. 2 with image from Zou et al., 2023
eye decreased size, abnormal AB + MO3-rel + MO4-tp53 Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO3-rel + MO4-tp53 Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO3-rel + MO4-tp53 Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO3-rel Fig. 6 from Bagheri et al., 2016
trunk curved, abnormal AB + MO3-rel + MO4-tp53 Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal AB + MO3-rel Fig. 6,  Fig. 7 from Bagheri et al., 2016
whole organism axin2 expression increased amount, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
whole organism sp5l expression increased amount, abnormal AB + MO3-rel Fig. 3 with image from Zou et al., 2023
Phenotype of all Fish created by or utilizing MO3-rel
Phenotype Fish Conditions Figures
blastoderm dorsal region dharma expression increased distribution, abnormal zf4368Tg/zf4368Tg + MO3-rel standard conditions Fig. 2 with image from Zou et al., 2023
blastoderm ventral region ventx expression decreased distribution, abnormal zf4368Tg/zf4368Tg + MO3-rel standard conditions Fig. 2 with image from Zou et al., 2023
blastoderm dorsal region d2EGFP expression decreased amount, abnormal zf4368Tg/zf4368Tg + MO3-rel standard conditions Fig. 2 with image from Zou et al., 2023
blastoderm dorsal region chrd expression increased distribution, abnormal zf4368Tg/zf4368Tg + MO3-rel standard conditions Fig. 2 with image from Zou et al., 2023
trunk morphology, abnormal AB + MO3-rel standard conditions Fig. 6 from Bagheri et al., 2016
blastodisc sp5l expression increased distribution, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
blastodisc sp5l expression increased amount, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
whole organism sp5l expression increased amount, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
dorsal/ventral pattern formation decreased process quality, abnormal AB + MO3-rel standard conditions Fig. 2 with image from Zou et al., 2023
blastoderm dorsal region chrd expression increased distribution, abnormal AB + MO3-rel standard conditions Fig. 4 with image from Zou et al., 2023
blastodisc axin2 expression increased amount, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
blastodisc dorsal side frzb expression decreased distribution, abnormal AB + MO3-rel standard conditions Fig. 4 with image from Zou et al., 2023
blastoderm dorsal region dharma expression increased distribution, abnormal AB + MO3-rel standard conditions Fig. 4 with image from Zou et al., 2023
head morphology, abnormal AB + MO3-rel standard conditions Fig. 6 from Bagheri et al., 2016
blastodisc axin2 expression increased distribution, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
whole organism axin2 expression increased amount, abnormal AB + MO3-rel standard conditions Fig. 3 with image from Zou et al., 2023
trunk morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6,  Fig. 7 from Bagheri et al., 2016
head decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
trunk curved, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
head morphology, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 6 from Bagheri et al., 2016
eye decreased size, abnormal AB + MO3-rel + MO4-tp53 standard conditions Fig. 7 from Bagheri et al., 2016
Citations