Morpholino
MO2-lrrc8aa
- ID
- ZDB-MRPHLNO-161201-2
- Name
- MO2-lrrc8aa
- Previous Names
- None
- Target
- Sequence
-
5' - ACACTATAAACCCAACGCACCTCCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lrrc8aa
No data available
Phenotype
Phenotype resulting from MO2-lrrc8aa
| Phenotype | Fish | Figures |
|---|---|---|
| volume-sensitive chloride channel activity decreased process quality, abnormal | EKW + MO2-lrrc8aa |
Fig. 4
from Yamada et al., 2016 |
Phenotype of all Fish created by or utilizing MO2-lrrc8aa
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| volume-sensitive chloride channel activity decreased process quality, abnormal | EKW + MO2-lrrc8aa | standard conditions |
Fig. 4
from Yamada et al., 2016 |
Citations