Morpholino
MO2-kif3a
- ID
- ZDB-MRPHLNO-161117-1
- Name
- MO2-kif3a
- Previous Names
- None
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - TTGCTCTGCAAAAAACACATGATCT - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- 
    
        
        
    
        
            Splice-blocking MO.
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO2-kif3a
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO2-kif3a
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Figures | 
|---|---|---|
| whole organism increased curvature, abnormal | WT + MO2-kif3a | text only
                    
                    from Khan et al., 2016 | 
                
                    
                        Phenotype of all Fish created by or utilizing MO2-kif3a
                    
                    
                
                
            
        
        
    
        
            
                
    
        
    | Phenotype | Fish | Conditions | Figures | 
|---|---|---|---|
| whole organism increased curvature, abnormal | WT + MO2-kif3a | standard conditions | text only
                    
                    from Khan et al., 2016 | 
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            
        
        
    
    
    