Morpholino
MO2-tars1
- ID
- ZDB-MRPHLNO-160629-1
- Name
- MO2-tars1
- Previous Names
-
- MO2-tars
- Target
- Sequence
-
5' - GATCAGTCACACTCTCATCCGCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tars1
No data available
Phenotype
Phenotype resulting from MO2-tars1
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-tars1
1 - 5 of 5
Citations
- Zhang, F., Zeng, Q.Y., Xu, H., Xu, A.N., Liu, D.J., Li, N.Z., Chen, Y., Jin, Y., Xu, C.H., Feng, C.Z., Zhang, Y.L., Liu, D., Liu, N., Xie, Y.Y., Yu, S.H., Yuan, H., Xue, K., Shi, J.Y., Liu, T.X., Xu, P.F., Zhao, W.L., Zhou, Y., Wang, L., Huang, Q.H., Chen, Z., Chen, S.J., Zhou, X.L., Sun, X.J. (2021) Selective and competitive functions of the AAR and UPR pathways in stress-induced angiogenesis. Cell discovery. 7:98
- Castranova, D., Davis, A.E., Lo, B.D., Miller, M.F., Paukstelis, P.J., Swift, M.R., Pham, V.N., Torres-Vázquez, J., Bell, K., Shaw, K.M., Kamei, M., Weinstein, B.M. (2016) Aminoacyl-Transfer RNA Synthetase Deficiency Promotes Angiogenesis via the Unfolded Protein Response Pathway. Arteriosclerosis, Thrombosis, and Vascular Biology. 36(4):655-62
1 - 2 of 2
Show