Morpholino
MO1-hexim1
- ID
- ZDB-MRPHLNO-160610-1
- Name
- MO1-hexim1
- Previous Names
- None
- Target
- Sequence
-
5' - TAATAAGCTCCATAACTGCACACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hexim1
No data available
Phenotype
Phenotype resulting from MO1-hexim1
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism hexim1 expression absent, abnormal | WT + MO1-hexim1 |
Fig. 4
from Sun et al., 2019 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-hexim1
from 1 - 5 of 8 Show all
Citations
- Sun, Y., Liu, Z., Cao, X., Lu, Y., Mi, Z., He, C., Liu, J., Zheng, Z., Li, M.J., Li, T., Xu, D., Wu, M., Cao, Y., Li, Y., Yang, B., Mei, C., Zhang, L., Chen, Y. (2019) Activation of P-TEFb by cAMP-PKA signaling in autosomal dominant polycystic kidney disease. Science advances. 5:eaaw3593
- Tan, J.L., Fogley, R.D., Flynn, R.A., Ablain, J., Yang, S., Saint-André, V., Fan, Z.P., Do, B.T., Laga, A.C., Fujinaga, K., Santoriello, C., Greer, C.B., Kim, Y.J., Clohessy, J.G., Bothmer, A., Pandell, N., Avagyan, S., Brogie, J.E., van Rooijen, E., Hagedorn, E.J., Shyh-Chang, N., White, R.M., Price, D.H., Pandolfi, P.P., Peterlin, B.M., Zhou, Y., Kim, T.H., Asara, J.M., Chang, H.Y., Young, R.A., Zon, L.I. (2016) Stress from Nucleotide Depletion Activates the Transcriptional Regulator HEXIM1 to Suppress Melanoma. Molecular Cell. 62:34-46
1 - 2 of 2
Show