Morpholino
MO1-adgrb1b
- ID
- ZDB-MRPHLNO-160413-3
- Name
- MO1-adgrb1b
- Previous Names
-
- 1 and 2 exons (1)
- Target
- Sequence
-
5' - CTAGAACTCTAACACACTTACTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgrb1b
No data available
Phenotype
Phenotype resulting from MO1-adgrb1b
No data available
Phenotype of all Fish created by or utilizing MO1-adgrb1b
1 - 5 of 13 Show all
Citations
- Zareba, J., Cattaneo, E.F., Villani, A., Othman, A., Streb, S., Peri, F. (2024) NPC1 links cholesterol trafficking to microglial morphology via the gastrosome. Nature communications. 15:86388638
- Iyer, H., Shen, K., Meireles, A.M., Talbot, W.S. (2022) A lysosomal regulatory circuit essential for the development and function of microglia. Science advances. 8:eabp8321
- Mikdache, A., Fontenas, L., Albadri, S., Revenu, C., Loisel-Duwattez, J., Lesport, E., Degerny, C., Del Bene, F., Tawk, M. (2019) Elmo1 function, linked to Rac1 activity, regulates peripheral neuronal numbers and myelination in zebrafish. Cellular and molecular life sciences : CMLS. 77(1):161-177
- Villani, A., Benjaminsen, J., Moritz, C., Henke, K., Hartmann, J., Norlin, N., Richter, K., Schieber, N.L., Franke, T., Schwab, Y., Peri, F. (2019) Clearance by Microglia Depends on Packaging of Phagosomes into a Unique Cellular Compartment. Developmental Cell. 49(1):77-88.e7
- Mazaheri, F., Breus, O., Durdu, S., Haas, P., Wittbrodt, J., Gilmour, D., Peri, F. (2014) Distinct roles for BAI1 and TIM-4 in the engulfment of dying neurons by microglia. Nature communications. 5:4046
1 - 5 of 5
Show