Morpholino
MO2-klc2
- ID
- ZDB-MRPHLNO-160210-6
- Name
- MO2-klc2
- Previous Names
-
- MOklc-SP (1)
- Target
- Sequence
-
5' - CGTGTGTGTTTCACCTGTGCTTCCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klc2
No data available
Phenotype
Phenotype resulting from MO2-klc2
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO2-klc2
1 - 5 of 11 Show all
Citations
- Martín, M., Modenutti, C.P., Gil Rosas, M.L., Peyret, V., Geysels, R.C., Bernal Barquero, C.E., Sobrero, G., Muñoz, L., Signorino, M., Testa, G., Miras, M.B., Masini-Repiso, A.M., Calcaterra, N.B., Coux, G., Carrasco, N., Martí, M.A., Nicola, J.P. (2021) A Novel SLC5A5 Variant Reveals the Crucial Role of Kinesin Light Chain 2 in Thyroid Hormonogenesis. The Journal of clinical endocrinology and metabolism. 106(7):1867-1881
- Melo, U.S., Macedo-Souza, L.I., Figueiredo, T., Muotri, A.R., Gleeson, J.G., Coux, G., Armas, P., Calcaterra, N.B., Kitajima, J.P., Amorim, S., Olávio, T.R., Griesi-Oliveira, K., Coatti, G.C., Rocha, C.R., Martins-Pinheiro, M., Menck, C.F., Zaki, M.S., Kok, F., Zatz, M., Santos, S. (2015) Overexpression of KLC2 due to a homozygous deletion in the non-coding region causes SPOAN syndrome. Human molecular genetics. 24(24):6877-85
1 - 2 of 2
Show