Morpholino

MO1-irf4a

ID
ZDB-MRPHLNO-160115-2
Name
MO1-irf4a
Previous Names
  • irf4a MOatg (1)
Target
Sequence
5' - TGATGCAGTCCCCATCTAAGTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irf4a
Phenotype
Phenotype resulting from MO1-irf4a
Phenotype Fish Figures
hematopoietic system leukocyte EGFP expression increased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased amount, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased distribution, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm leukocyte increased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm macrophage increased amount, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm neutrophil increased amount, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
lymphoid lineage cell migration into thymus decreased process quality, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
macrophage mfap4.1 expression increased distribution, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
neutrophil lyz expression increased distribution, abnormal WT + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus coro1a expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus myb expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus ikzf1 expression absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus EGFP expression absent, abnormal hkz04tTg + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus ccr9a expression absent, abnormal WT + MO1-irf4a Fig. 3 with image from Wang et al., 2015
thymus hematopoietic stem cell migration decreased occurrence, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus leukocyte decreased amount, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased distribution, abnormal hkz04tTg + MO1-irf4a Fig. 5 with image from Wang et al., 2015
thymus T cell absent, abnormal WT + MO1-irf4a Fig. 2 with image from Wang et al., 2015
thymus primordium EGFP expression absent, abnormal hkz04tTg; nz50Tg + MO1-irf4a Fig. 3 with image from Wang et al., 2015
whole organism spi1b expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
whole organism lyz expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
whole organism csf3r expression increased amount, abnormal WT + MO1-irf4a Fig. 6 from Wang et al., 2015
Phenotype of all Fish created by or utilizing MO1-irf4a
Phenotype Fish Conditions Figures
whole organism csf3r expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
macrophage mfap4.1 expression increased distribution, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased distribution, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
intermediate cell mass of mesoderm macrophage increased amount, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus ccr9a expression absent, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus T cell absent, abnormal WT + MO1-irf4a standard conditions Fig. 2 with image from Wang et al., 2015
neutrophil lyz expression increased distribution, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm neutrophil increased amount, abnormal WT + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus coro1a expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
whole organism lyz expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
intermediate cell mass of mesoderm ccr9a expression decreased amount, abnormal WT + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
whole organism spi1b expression increased amount, abnormal WT + MO1-irf4a standard conditions Fig. 6 from Wang et al., 2015
thymus ikzf1 expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
thymus myb expression absent, abnormal WT + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
hematopoietic system leukocyte EGFP expression increased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
intermediate cell mass of mesoderm leukocyte increased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus EGFP expression absent, abnormal hkz04tTg + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
thymus leukocyte EGFP expression decreased distribution, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus leukocyte decreased amount, abnormal hkz04tTg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
thymus hematopoietic multipotent progenitor cell decreased amount, abnormal zf169Tg + MO1-irf4a control Fig. 2 with image from Wang et al., 2015
lymphoid lineage cell migration into thymus decreased process quality, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus primordium EGFP expression absent, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
thymus hematopoietic stem cell migration decreased occurrence, abnormal hkz04tTg; nz50Tg + MO1-irf4a control Fig. 3 with image from Wang et al., 2015
myeloid cell differentiation increased occurrence, abnormal nz50Tg; zf169Tg + MO1-irf4a control Fig. 5 with image from Wang et al., 2015
Citations