Morpholino

MO1-rnasel2, rnasel5

ID

ZDB-MRPHLNO-151123-3

Previous Names

MO1-rnasel2

Targets

rnasel2 (1)
rnasel5 (1)

Sequence

5' - CGGCAGACTGAAGAATCTCCATGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rnasel2, rnasel5

Expressed Gene	Anatomy	Figures
baxa	whole organism	Fig. 5 from Zhai et al., 2015
cdkn1a	whole organism	Fig. 5 from Zhai et al., 2015
tp53	whole organism	Fig. 5 from Zhai et al., 2015

Phenotype

Phenotype resulting from MO1-rnasel2, rnasel5

No data available

Phenotype of all Fish created by or utilizing MO1-rnasel2, rnasel5

Phenotype	Fish	Conditions	Figures
whole organism tp53 expression increased amount, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 5 from Zhai et al., 2015
yolk syncytial layer apoptotic DNA fragmentation increased occurrence, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 4 from Zhai et al., 2015
hatching delayed, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 2 from Zhai et al., 2015
whole organism baxa expression increased amount, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 5 from Zhai et al., 2015
extension hypotrophic, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 3, Fig. 5 from Zhai et al., 2015
hatching disrupted, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 2 from Zhai et al., 2015
whole organism cdkn1a expression increased amount, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 5 from Zhai et al., 2015
whole organism dead, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 2 from Zhai et al., 2015
extension morphology, abnormal	AB + MO1-rnasel2, rnasel5	standard conditions	Fig. 3, Fig. 5 from Zhai et al., 2015
hatching delayed, ameliorated	AB + MO1-rnasel2, rnasel5 + MO4-tp53	standard conditions	text only from Zhai et al., 2015
extension decreased area, ameliorated	AB + MO1-rnasel2, rnasel5 + MO4-tp53	standard conditions	Fig. 5 from Zhai et al., 2015
extension morphology, ameliorated	AB + MO1-rnasel2, rnasel5 + MO4-tp53	standard conditions	Fig. 5 from Zhai et al., 2015
hatching delayed, ameliorated	tp53^zdf1/zdf1 + MO1-rnasel2, rnasel5	standard conditions	text only from Zhai et al., 2015
extension morphology, ameliorated	tp53^zdf1/zdf1 + MO1-rnasel2, rnasel5	standard conditions	Fig. 5 from Zhai et al., 2015
extension decreased area, ameliorated	tp53^zdf1/zdf1 + MO1-rnasel2, rnasel5	standard conditions	Fig. 5 from Zhai et al., 2015
sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-rnasel2, rnasel5	standard conditions	Fig. 2 from Zhai et al., 2015
intersegmental vessel immature, abnormal	y1Tg + MO1-rnasel2, rnasel5	standard conditions	Fig. 2 from Zhai et al., 2015

Citations