Morpholino

MO2-tmem165

ID
ZDB-MRPHLNO-151002-2
Name
MO2-tmem165
Previous Names
None
Target
Sequence
5' - TGGTCATCATCGCTGAGAGACCGAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tmem165
Expressed Gene Anatomy Figures
acana Fig. 5 from Bammens et al., 2015
col2a1a Fig. 5 from Bammens et al., 2015
col10a1a Fig. 6 from Bammens et al., 2015
sox9a Fig. 5 from Bammens et al., 2015
sp7 Fig. 6 from Bammens et al., 2015
Phenotype
Phenotype resulting from MO2-tmem165
Phenotype Fish Figures
bone mineralization disrupted, abnormal WT + MO2-tmem165 Fig. 6 from Bammens et al., 2015
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
ceratohyal cartilage position, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
ceratohyal cartilage cell decreased amount, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
chondrocyte decreased amount, abnormal y1Tg/+ + MO2-tmem165 (AB) Fig. 4 from Bammens et al., 2015
chondrocyte differentiation disrupted, abnormal WT + MO2-tmem165 Fig. 5 from Bammens et al., 2015
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-tmem165 Fig. 7 from Bammens et al., 2015
mandibular arch skeleton truncated, abnormal WT + MO2-tmem165 Fig. 3 from Bammens et al., 2015
Meckel's cartilage shape, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
Meckel's cartilage cell decreased amount, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
osteoblast differentiation disrupted, abnormal WT + MO2-tmem165 Fig. 6 from Bammens et al., 2015
palatoquadrate cartilage cell decreased amount, abnormal WT + MO2-tmem165 Fig. 4 from Bammens et al., 2015
protein N-linked glycosylation disrupted, abnormal WT + MO2-tmem165 Fig. 8 from Bammens et al., 2015
whole organism decreased length, abnormal WT + MO2-tmem165 Fig. 3 from Bammens et al., 2015
Phenotype of all Fish created by or utilizing MO2-tmem165
Phenotype Fish Conditions Figures
osteoblast differentiation disrupted, abnormal WT + MO2-tmem165 standard conditions Fig. 6 from Bammens et al., 2015
bone mineralization disrupted, abnormal WT + MO2-tmem165 standard conditions Fig. 6 from Bammens et al., 2015
protein N-linked glycosylation disrupted, abnormal WT + MO2-tmem165 standard conditions Fig. 8 from Bammens et al., 2015
ceratohyal cartilage cell decreased amount, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
palatoquadrate cartilage cell decreased amount, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
Meckel's cartilage cell decreased amount, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-tmem165 standard conditions Fig. 7 from Bammens et al., 2015
chondrocyte differentiation disrupted, abnormal WT + MO2-tmem165 standard conditions Fig. 5 from Bammens et al., 2015
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
Meckel's cartilage shape, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
ceratohyal cartilage position, abnormal WT + MO2-tmem165 standard conditions Fig. 4 from Bammens et al., 2015
whole organism decreased length, abnormal WT + MO2-tmem165 standard conditions Fig. 3 from Bammens et al., 2015
mandibular arch skeleton truncated, abnormal WT + MO2-tmem165 standard conditions Fig. 3 from Bammens et al., 2015
chondrocyte decreased amount, abnormal y1Tg/+ + MO2-tmem165 (AB) standard conditions Fig. 4 from Bammens et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.