Morpholino
MO3-bptf
- ID
- ZDB-MRPHLNO-150923-3
- Name
- MO3-bptf
- Previous Names
- None
- Target
- Sequence
-
5' - TCCGACGAAGCGTCCGTACCTGTGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bptf
No data available
Phenotype
Phenotype resulting from MO3-bptf
Phenotype | Fish | Figures |
---|---|---|
whole organism bptf expression decreased amount, abnormal | TU + MO3-bptf |
Fig. 1
from Ma et al., 2015 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-bptf
1 - 5 of 28 Show all
Citations
- Ding, Y., Wang, W., Ma, D., Liang, G., Kang, Z., Xue, Y., Zhang, Y., Wang, L., Heng, J., Zhang, Y., Liu, F. (2020) Smarca5 mediated epigenetic programming facilitates fetal HSPC development in vertebrates. Blood. 137(2):190-202
- Ma, Y., Liu, X., Liu, Z., Wei, S., Shang, H., Xue, Y., Cao, Y., Meng, A., Wang, Q. (2015) The Chromatin Remodeling Protein Bptf Promotes Posterior Neuroectodermal Fate by Enhancing Smad2-Activated wnt8a Expression. The Journal of neuroscience : the official journal of the Society for Neuroscience. 35:8493-506
1 - 2 of 2
Show