Morpholino
MO2-sirt2
- ID
- ZDB-MRPHLNO-150911-2
- Name
- MO2-sirt2
- Previous Names
- None
- Target
- Sequence
-
5' - ACCTCTAAAGGACACAAAAAAGGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
intron 1 exon 2 splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sirt2
No data available
Phenotype
Phenotype resulting from MO2-sirt2
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-sirt2
1 - 5 of 8 Show all
Citations
- Hayasaka, O., Shibukawa, M., Kamei, H. (2024) Cellular Energy Sensor Sirt1 Augments Mapk Signaling to Promote Hypoxia/Reoxygenation-Induced Catch-up Growth in Zebrafish Embryo. Zoological science. 41:213121-31
- Morishima, T., Krahl, A.C., Nasri, M., Xu, Y., Aghaallaei, N., Findik, B., Klimiankou, M., Ritter, M., Hartmann, M.D., Gloeckner, C.J., Stefańczyk, S., Lindner, C., Oswald, B., Bernhard, R., Hähnel, K., Hermanutz-Klein, U., Ebinger, M., Handgretinger, R., Casadei, N., Welte, K., Andre, M., Müller, P., Bajoghli, B., Skokowa, J. (2019) LMO2 activation by deacetylation is indispensable for hematopoiesis and T-ALL leukemogenesis. Blood. 134(14):1159-1175
- Zhou, X., Fan, L.X., Li, K., Ramchandran, R., Calvet, J.P., and Li, X. (2014) SIRT2 regulates ciliogenesis and contributes to abnormal centrosome amplification caused by loss of polycystin-1. Human molecular genetics. 23(6):1644-55
1 - 3 of 3
Show