Morpholino

MO1-rab5b

ID
ZDB-MRPHLNO-150409-5
Name
MO1-rab5b
Previous Names
None
Target
Sequence
5' - CCTGCCTGTCCCACGGGTACTCATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab5b
No data available
Phenotype
Phenotype resulting from MO1-rab5b
Phenotype Fish Figures
brain morphology, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
forebrain decreased size, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5b + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
notochord curved, abnormal WT + MO1-rab5b + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
skeletal muscle morphology, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
somite decreased thickness, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
somite shape, abnormal WT + MO1-rab5b + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5b + MO4-tp53 Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5b Fig. 2 with image from Kenyon et al., 2015
Phenotype of all Fish created by or utilizing MO1-rab5b
Phenotype Fish Conditions Figures
notochord curved, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle morphology, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
somite decreased thickness, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
brain morphology, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
somite shape, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
forebrain decreased size, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
brain necrotic, abnormal WT + MO1-rab5b standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
somite shape, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
notochord curved, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
head decreased size, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
skeletal muscle morphology, abnormal WT + MO1-rab5b + MO4-tp53 standard conditions Fig. 2 with image from Kenyon et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.