Morpholino
MO7-notch1b
- ID
- ZDB-MRPHLNO-150209-2
- Name
- MO7-notch1b
- Previous Names
- None
- Target
- Sequence
-
5' - GTCGAGAATCTTATCACTTACTTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-notch1b
No data available
Phenotype
Phenotype resulting from MO7-notch1b
| Phenotype | Fish | Figures |
|---|---|---|
| hematopoietic progenitor cell differentiation process quality, abnormal | AB + MO7-notch1b |
Fig. S4
from Kim et al., 2014 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO7-notch1b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| hematopoietic progenitor cell differentiation process quality, abnormal | AB + MO7-notch1b | standard conditions |
Fig. S4
from Kim et al., 2014 |
1 - 1 of 1
Citations
- Butko, E., Distel, M., Pouget, C., Weijts, B., Kobayashi, I., Ng, K., Mosimann, C., Poulain, F.E., McPherson, A., Ni, C.W., Stachura, D.L., Del Cid, N., Espín-Palazón, R., Lawson, N.D., Dorsky, R., Clements, W.K., Traver, D. (2015) Gata2b is a restricted early regulator of hemogenic endothelium in the zebrafish embryo. Development (Cambridge, England). 142:1050-61
- Kim, A.D., Melick, C.H., Clements, W.K., Stachura, D.L., Distel, M., Panáková, D., MacRae, C., Mork, L.A., Crump, J.G., Traver, D. (2014) Discrete Notch signaling requirements in the specification of hematopoietic stem cells. The EMBO journal. 33(20):2363-73
1 - 2 of 2
Show