Morpholino
MO1-mymk
- ID
- ZDB-MRPHLNO-150106-1
- Name
- MO1-mymk
- Previous Names
-
- MO1-tmem8c
- Target
- Sequence
-
5' - TCTTGGCGATAAACGCTCCCATTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mymk
No data available
Phenotype
Phenotype resulting from MO1-mymk
from 1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-mymk
1 - 5 of 8 Show all
Citations
- Arribat, Y., Grepper, D., Lagarrigue, S., Richard, J., Gachet, M., Gut, P., Amati, F. (2019) Mitochondria in Embryogenesis: An Organellogenesis Perspective. Frontiers in cell and developmental biology. 7:282
- Di Gioia, S.A., Connors, S., Matsunami, N., Cannavino, J., Rose, M.F., Gilette, N.M., Artoni, P., de Macena Sobreira, N.L., Chan, W.M., Webb, B.D., Robson, C.D., Cheng, L., Van Ryzin, C., Ramirez-Martinez, A., Mohassel, P., Leppert, M., Scholand, M.B., Grunseich, C., Ferreira, C.R., Hartman, T., Hayes, I.M., Morgan, T., Markie, D.M., Fagiolini, M., Swift, A., Chines, P.S., Speck-Martins, C.E., Collins, F.S., Jabs, E.W., Bönnemann, C.G., Olson, E.N., Carey, J.C., Robertson, S.P., Manoli, I., Engle, E.C. (2017) A defect in myoblast fusion underlies Carey-Fineman-Ziter syndrome. Nature communications. 8:16077
- Landemaine, A., Rescan, P.Y., Gabillard, J.C. (2014) Myomaker mediates fusion of fast myocytes in zebrafish embryos. Biochemical and Biophysical Research Communications. 451(4):480-4
1 - 3 of 3
Show