Morpholino
MO2-kdm6a
- ID
- ZDB-MRPHLNO-141121-14
- Name
- MO2-kdm6a
- Previous Names
- None
- Target
- Sequence
-
5' - GGAAACGGACTTTAACTGACCTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-kdm6a
No data available
Phenotype
Phenotype resulting from MO2-kdm6a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-kdm6a
1 - 5 of 13 Show all
Citations
- Tsai, I.C., McKnight, K., McKinstry, S.U., Maynard, A.T., Tan, P.L., Golzio, C., White, C.T., Price, D.J., Davis, E.E., Amrine-Madsen, H., Katsanis, N. (2018) Small molecule inhibition of RAS/MAPK signaling ameliorates developmental pathologies of Kabuki Syndrome. Scientific Reports. 8:10779
- Bögershausen, N., Tsai, I.C., Pohl, E., Kiper, P.Ö., Beleggia, F., Percin, E.F., Keupp, K., Matchan, A., Milz, E., Alanay, Y., Kayserili, H., Liu, Y., Banka, S., Kranz, A., Zenker, M., Wieczorek, D., Elcioglu, N., Prontera, P., Lyonnet, S., Meitinger, T., Stewart, A.F., Donnai, D., Strom, T.M., Boduroglu, K., Yigit, G., Li, Y., Katsanis, N., Wollnik, B. (2015) RAP1-mediated MEK/ERK pathway defects in Kabuki syndrome. The Journal of Clinical Investigation. 125(9):3585-99
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
1 - 3 of 3
Show