Morpholino
MO1-hdac8
- ID
- ZDB-MRPHLNO-141119-24
- Name
- MO1-hdac8
- Previous Names
- None
- Target
- Sequence
-
5' - ATTACTGTCGCTTTTTTCACTCATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hdac8
No data available
Phenotype
Phenotype resulting from MO1-hdac8
No data available
Phenotype of all Fish created by or utilizing MO1-hdac8
from 1 - 3 of 3
Citations
- Volpatti, J.R., Ghahramani-Seno, M.M., Mansat, M., Sabha, N., Sarikaya, E., Goodman, S.J., Chater-Diehl, E., Celik, A., Pannia, E., Froment, C., Combes-Soia, L., Maani, N., Yuki, K.E., Chicanne, G., Uusküla-Reimand, L., Monis, S., Alvi, S.A., Genetti, C.A., Payrastre, B., Beggs, A.H., Bonnemann, C.G., Muntoni, F., Wilson, M.D., Weksberg, R., Viaud, J., Dowling, J.J. (2022) X-linked myotubular myopathy is associated with epigenetic alterations and is ameliorated by HDAC inhibition. Acta Neuropathologica. 144(3):537-563
- Zhuang, M., Scholz, A., Walz, G., Yakulov, T.A. (2022) Histone Deacetylases Cooperate with NF-κB to Support the Immediate Migratory Response after Zebrafish Pronephros Injury. International Journal of Molecular Sciences. 23(17)
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
1 - 3 of 3
Show