Morpholino

MO1-ezh1

ID

ZDB-MRPHLNO-141118-18

Name

MO1-ezh1

Previous Names

None

Target

ezh1 (1)

Sequence

5' - TGTGATTTCTACACACCTCTCCACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ezh1

Expressed Gene	Anatomy	Figures
dlc	artery	Fig. 3 from Soto et al., 2021
dll4	artery	Fig. 3 from Soto et al., 2021
efnb2a	artery	Fig. 3 from Soto et al., 2021
ezh2	whole organism	Fig. 4 from Soto et al., 2021
gata2b	blood vessel endothelium whole organism	Fig. 2 from Soto et al., 2021
myb	dorsal aorta	Fig. 1 , Fig. 2 from Soto et al., 2021
rag1	thymus	Fig. 1 from Soto et al., 2021
runx1	dorsal aorta whole organism	Fig. 1 from Soto et al., 2021
tbx20	artery	Fig. 3 from Soto et al., 2021

Phenotype

Phenotype resulting from MO1-ezh1

Phenotype	Fish	Figures
artery tbx20 expression decreased amount, abnormal	AB + MO1-ezh1	Fig. 3 from Soto et al., 2021
artery efnb2a expression decreased amount, abnormal	AB + MO1-ezh1	Fig. 3 from Soto et al., 2021
artery dll4 expression decreased amount, abnormal	AB + MO1-ezh1	Fig. 3 from Soto et al., 2021
artery dlc expression decreased amount, abnormal	AB + MO1-ezh1	Fig. 3 from Soto et al., 2021
blood vessel endothelium gata2b expression increased amount, abnormal	AB + MO1-ezh1	Fig. 2 from Soto et al., 2021
blood vessel endothelium ab1-efnb2 labeling spatial pattern, abnormal	AB + MO1-ezh1	Fig. 3 from Soto et al., 2021
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression increased amount, abnormal	la2Tg/la2Tg + MO1-ezh1	Fig. 1 , Fig. 4 from Soto et al., 2021
dorsal aorta runx1 expression increased amount, abnormal	AB + MO1-ezh1	Fig. 1 from Soto et al., 2021
dorsal aorta myb expression increased amount, abnormal	AB + MO1-ezh1	Fig. 1 , Fig. 2 from Soto et al., 2021
lymphoid progenitor cell EGFP expression increased amount, abnormal	zdf8Tg/zdf8Tg + MO1-ezh1	Fig. 1 from Soto et al., 2021
thymus rag1 expression increased amount, abnormal	AB + MO1-ezh1	Fig. 1 from Soto et al., 2021
vascular endothelium hematopoietic progenitor cell differentiation increased occurrence, abnormal	AB + MO1-ezh1	Fig. 2 from Soto et al., 2021
whole organism runx1 expression increased amount, abnormal	AB + MO1-ezh1	Fig. 1 from Soto et al., 2021
whole organism gata2b expression increased amount, abnormal	AB + MO1-ezh1	Fig. 2 from Soto et al., 2021
whole organism ezh2 expression increased amount, abnormal	AB + MO1-ezh1	Fig. 4 from Soto et al., 2021

Phenotype of all Fish created by or utilizing MO1-ezh1

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression increased amount, abnormal	la2Tg/la2Tg + MO1-ezh1	standard conditions	Fig. 1 , Fig. 4 from Soto et al., 2021
caudal hematopoietic tissue hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal	la2Tg/la2Tg + MO1-ezh1	chemical treatment by environment: EC 2.1.1.43 (enhancer of zeste homolog 2) inhibitor	Fig. 4 from Soto et al., 2021
lymphoid progenitor cell EGFP expression increased amount, abnormal	zdf8Tg/zdf8Tg + MO1-ezh1	standard conditions	Fig. 1 from Soto et al., 2021
dorsal aorta myb expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 1 , Fig. 2 from Soto et al., 2021
thymus rag1 expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 1 from Soto et al., 2021
artery dll4 expression decreased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
artery dlc expression decreased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
whole organism ezh2 expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 4 from Soto et al., 2021
blood vessel endothelium gata2b expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
dorsal aorta runx1 expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 1 from Soto et al., 2021
artery efnb2a expression decreased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
artery tbx20 expression decreased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
whole organism runx1 expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 1 from Soto et al., 2021
vascular endothelium hematopoietic progenitor cell differentiation increased occurrence, abnormal	AB + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
whole organism gata2b expression increased amount, abnormal	AB + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
blood vessel endothelium ab1-efnb2 labeling spatial pattern, abnormal	AB + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
blood vessel endothelium mCherry expression increased amount, abnormal	s916Tg/s916Tg; zf255Tg/zf255Tg + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
blood vessel endothelium EGFP expression increased amount, abnormal	s916Tg/s916Tg; zf255Tg/zf255Tg + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
blood vessel endothelial cell fate specification increased frequency, abnormal	s916Tg/s916Tg; zf255Tg/zf255Tg + MO1-ezh1	standard conditions	Fig. 2 from Soto et al., 2021
dorsal aorta hematopoietic multipotent progenitor cell mCherry expression increased amount, abnormal	s916Tg/s916Tg; zf169Tg/zf169Tg + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021
dorsal aorta hematopoietic multipotent progenitor cell GFP expression increased amount, abnormal	s916Tg/s916Tg; zf169Tg/zf169Tg + MO1-ezh1	standard conditions	Fig. 3 from Soto et al., 2021

Citations