Morpholino
MO3-setdb2
- ID
- ZDB-MRPHLNO-141118-10
- Name
- MO3-setdb2
- Previous Names
- 
    
        
    
    
        
        - exon6 (1)
 
- Target
- Sequence
- 
    
        
        
    
        
            
                5' - CACGCACACAGATGACTGACCCTGT - 3'
                
            
            
                
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
                
                    
                        Target Location
                    
                    
                
                
            
        
        
    
        
            
            
    
        
    
    
    
        
        
    
    
    
                
                    
                        Genomic Features
                    
                    
                
                
            
        
        
    
        
            
            
    
    
        
    
No data available
    
        
        
    
    
    
                
                    
                        Expression
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Gene expression in Wild Types + MO3-setdb2
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype
                    
                    
                
                
            
        
        
    
        
            
            
    
    
                
                    
                        Phenotype resulting from MO3-setdb2
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Phenotype of all Fish created by or utilizing MO3-setdb2
                    
                    
                
                
            
        
        
    
        
            
                
    
    
        
    
No data available
    
            
        
    
    
    
                
                    
                        Citations
                    
                    
                
                
            
        
        
    
        
            
            - Calvird, A.E., Broniec, M.N., Duval, K.L., Higgs, A.N., Arora, V., Ha, L.N., Schouten, E.B., Crippen, A.R., McGrail, M., Laue, K., Goll, M.G. (2022) Uncovering Regulators of Heterochromatin Mediated Silencing Using a Zebrafish Transgenic Reporter. Frontiers in cell and developmental biology. 10:832461
- Huang, H.T., Kathrein, K.L., Barton, A., Gitlin, Z., Huang, Y.H., Ward, T.P., Hofmann, O., Dibiase, A., Song, A., Tyekucheva, S., Hide, W., Zhou, Y., and Zon, L.I. (2013) A network of epigenetic regulators guides developmental haematopoiesis in vivo. Nature cell biology. 15(12):1516-1525
1 - 2 of 2
Show
