Morpholino
MO1-sqstm1
- ID
- ZDB-MRPHLNO-140826-3
- Name
- MO1-sqstm1
- Previous Names
-
- Intron 1 > exon 2 (1)
- Target
- Sequence
-
5' - CTTCATCTAGAGACAAAGTTCAGGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sqstm1
No data available
Phenotype
Phenotype resulting from MO1-sqstm1
No data available
Phenotype of all Fish created by or utilizing MO1-sqstm1
from 1 - 5 of 7 Show all
Citations
- Gibson, J.F., Prajsnar, T.K., Hill, C.J., Tooke, A.K., Serba, J.J., Tonge, R.D., Foster, S.J., Grierson, A.J., Ingham, P.W., Renshaw, S.A., Johnston, S.A. (2020) Neutrophils use selective autophagy receptor Sqstm1/p62 to target Staphylococcus aureus for degradation in vivo in zebrafish. Autophagy. 17(6):1448-1457
- Prajsnar, T.K., Serba, J.J., Dekker, B.M., Gibson, J.F., Masud, S., Fleming, A., Johnston, S.A., Renshaw, S.A., Meijer, A.H. (2020) The autophagic response to Staphylococcus aureus provides an intracellular niche in neutrophils. Autophagy. 17(4):888-902
- Zhang, R., Varela, M., Vallentgoed, W., Forn-Cuni, G., van der Vaart, M., Meijer, A.H. (2019) The selective autophagy receptors Optineurin and p62 are both required for zebrafish host resistance to mycobacterial infection. PLoS pathogens. 15:e1007329
- Mans, L.A., Querol Cano, L., van Pelt, J., Giardoglou, P., Keune, W.J., Haramis, A.G. (2017) The tumor suppressor LKB1 regulates starvation-induced autophagy under systemic metabolic stress. Scientific Reports. 7:7327
- van der Vaart, M., Korbee, C.J., Lamers, G.E., Tengeler, A.C., Hosseini, R., Haks, M.C., Ottenhoff, T.H., Spaink, H.P., Meijer, A.H. (2014) The DNA Damage-Regulated Autophagy Modulator DRAM1 Links Mycobacterial Recognition via TLR-MYD88 to Autophagic Defense. Cell Host & Microbe. 15(6):753-767
1 - 5 of 5
Show