Morpholino
MO6-notch1b
- ID
- ZDB-MRPHLNO-140808-3
- Name
- MO6-notch1b
- Previous Names
-
- exon 8 splice donor site (1)
- Target
- Sequence
-
5' - GTTCCTCCGGTTACCTGGCATACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-notch1b
No data available
Phenotype
Phenotype resulting from MO6-notch1b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO6-notch1b
1 - 4 of 4
Citations
- Kugler, E.C., Frost, J., Silva, V., Plant, K., Chhabria, K., Chico, T.J.A., Armitage, P.A. (2022) Zebrafish Vascular Quantification (ZVQ): a tool for quantification of three-dimensional zebrafish cerebrovascular architecture by automated image analysis. Development (Cambridge, England). 149(3):
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- Kugler, E.C., van Lessen, M., Daetwyler, S., Chhabria, K., Savage, A.M., Silva, V., Plant, K., MacDonald, R.B., Huisken, J., Wilkinson, R.N., Schulte-Merker, S., Armitage, P., Chico, T.J. (2019) Cerebrovascular endothelial cells form transient Notch-dependent cystic structures in zebrafish. EMBO reports. 20:e47047
- Kim, A.D., Melick, C.H., Clements, W.K., Stachura, D.L., Distel, M., Panáková, D., MacRae, C., Mork, L.A., Crump, J.G., Traver, D. (2014) Discrete Notch signaling requirements in the specification of hematopoietic stem cells. The EMBO journal. 33(20):2363-73
- Quillien, A., Moore, J.C., Shin, M., Siekmann, A.F., Smith, T., Pan, L., Moens, C.B., Parsons, M.J., Lawson, N.D. (2014) Distinct Notch signaling outputs pattern the developing arterial system. Development (Cambridge, England). 141:1544-52
1 - 5 of 5
Show