Morpholino

MO4-bbs4

ID
ZDB-MRPHLNO-140729-2
Name
MO4-bbs4
Previous Names
None
Target
Sequence
5' - CCGTTCTCATAGCGTCGTCCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-bbs4
No data available
Phenotype
Phenotype resulting from MO4-bbs4
Phenotype of all Fish created by or utilizing MO4-bbs4
Phenotype Fish Conditions Figures
proximal convoluted tubule development decreased occurrence, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
proximal convoluted tubule atrophied, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2Fig. S4Fig. S11 from Tsai et al., 2019
proximal convoluted tubule morphology, abnormal AB/EKW + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension disrupted, abnormal WT + MO4-bbs4 standard conditions Fig. 5Fig. S5Fig. S6 from Liu et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO4-bbs4 standard conditions Fig. 5Fig. S6 from Liu et al., 2014
somite increased width, abnormal WT + MO4-bbs4 standard conditions Fig. 5Fig. S6 from Liu et al., 2014
somite border amorphous, abnormal WT + MO4-bbs4 standard conditions Fig. 5Fig. S5Fig. S6 from Liu et al., 2014
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-dtx1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-engase + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, exacerbated AB/EKW + MO1-enpp7.1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-entpd6 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation decreased occurrence, abnormal AB/EKW + MO1-pitpnm2 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-ptmaa + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-rtraf + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-tdrd12 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-tex36 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
proximal convoluted tubule morphology, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2Fig. S11 from Tsai et al., 2019
proximal convoluted tubule atrophied, ameliorated AB/EKW + MO1-usp38 + MO4-bbs4 standard conditions Fig. 2 from Tsai et al., 2019
convergent extension involved in axis elongation occurrence, ameliorated AB/EKW + MO2-zic1 + MO4-bbs4 standard conditions Fig. S4 from Tsai et al., 2019
Citations