Morpholino
MO1-fhl1a
- ID
- ZDB-MRPHLNO-140707-2
- Name
- MO1-fhl1a
- Previous Names
-
- fhlA-MO1 (1)
- Target
- Sequence
-
5' - GTCTGCTATCTGGAAAAACAGAAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fhl1a
No data available
Phenotype
Phenotype resulting from MO1-fhl1a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-fhl1a
1 - 5 of 28 Show all
Citations
- Chen, F., Yuan, W., Mo, X., Zhuang, J., Wang, Y., Chen, J., Jiang, Z., Zhu, X., Zeng, Q., Wan, Y., Li, F., Shi, Y., Cao, L., Fan, X., Luo, S., Ye, X., Chen, Y., Dai, G., Gao, J., Wang, X., Xie, H., Zhu, P., Li, Y., Wu, X. (2018) Role of zebrafish fhl1A in satellite cell and skeletal muscle development. Current Molecular Medicine. 17(9):627-636
- Xie, H., Fan, X., Tang, X., Wan, Y., Chen, F., Wang, X., Wang, Y., Li, Y., Tang, M., Liu, D., Jiang, Z., Liu, X., Yuan, W., Li, G., Ye, X., Zhou, J., Deng, Y., and Wu, X. (2013) The LIM protein fhlA is essential for heart chamber development in zebrafish embryos. Current Molecular Medicine. 13(6):979-92
1 - 2 of 2
Show