Morpholino

MO1-smad9

ID
ZDB-MRPHLNO-140620-6
Name
MO1-smad9
Previous Names
None
Target
Sequence
5' - TCGTGAGACGGGTTGATTTTAAATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smad9
No data available
Phenotype
Phenotype resulting from MO1-smad9
Phenotype Fish Figures
blood vasculature misrouted, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
blood vessel morphogenesis disrupted, abnormal zf531Tg + MO1-smad9 Fig. 4 with imageFig. 6 with image from Walcott et al., 2018
brain vasculature lacks parts or has fewer parts of type central artery, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
caudal vein plexus decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
central nervous system degenerate, abnormal WT + MO1-smad9 Fig. 3 from Wei et al., 2014
dorsal longitudinal vein attached to mesencephalic vein, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic artery, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
eye decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
granulocyte decreased amount, abnormal WT + MO1-smad9 Fig. 7 from Wei et al., 2014
head decreased size, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
intersegmental vessel has extra parts of type angiogenic sprout, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta increased diameter, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
lateral dorsal aorta shape, abnormal zf531Tg + MO1-smad9 Fig. 6 with image from Walcott et al., 2018
macrophage decreased amount, abnormal WT + MO1-smad9 Fig. 7 from Wei et al., 2014
pericardium edematous, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
trunk decreased width, abnormal zf531Tg + MO1-smad9 Fig. 4 with image from Walcott et al., 2018
Phenotype of all Fish created by or utilizing MO1-smad9
Phenotype Fish Conditions Figures
macrophage decreased amount, abnormal WT + MO1-smad9 standard conditions Fig. 7 from Wei et al., 2014
central nervous system degenerate, abnormal WT + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
granulocyte decreased amount, abnormal WT + MO1-smad9 standard conditions Fig. 7 from Wei et al., 2014
blood vasculature misrouted, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
head decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
trunk decreased width, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
blood vessel morphogenesis disrupted, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with imageFig. 6 with image from Walcott et al., 2018
intersegmental vessel has extra parts of type angiogenic sprout, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta shape, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
pericardium edematous, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
brain vasculature lacks parts or has fewer parts of type central artery, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
caudal vein plexus decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic vein, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
lateral dorsal aorta increased diameter, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 6 with image from Walcott et al., 2018
eye decreased size, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
dorsal longitudinal vein attached to mesencephalic artery, abnormal zf531Tg + MO1-smad9 standard conditions Fig. 4 with image from Walcott et al., 2018
whole organism wholly dorsalized, abnormal WT + MO1-smad5 + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal WT + MO1-smad5 + MO1-smad9 standard conditions Fig. 3 from Wei et al., 2014
dorsal/ventral pattern formation process quality, abnormal WT + MO1-smad9 + MO3-smad1 standard conditions Fig. 4 from Wei et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-smad9 + MO3-smad1 standard conditions Fig. 4 from Wei et al., 2014
Citations