Morpholino

MO1-bcl2l16

ID

ZDB-MRPHLNO-140619-1

Name

MO1-bcl2l16

Previous Names

bclwav MO1 (1)

Target

bcl2l16 (1)

Sequence

5' - CATCAGCTCAGATACACACAGGTCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bcl2l16

No data available

Phenotype

Phenotype resulting from MO1-bcl2l16

Phenotype	Fish	Figures
actin polymerization or depolymerization process quality, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 5 from Prudent et al., 2013
anterior/posterior axis specification disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 3 from Prudent et al., 2013
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 4 from Prudent et al., 2013
embryo development disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 3 from Prudent et al., 2013
mesodermal cell filamentous actin oriented, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 5 from Prudent et al., 2013
mitochondrial calcium ion transmembrane transport disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 6 from Prudent et al., 2013
notochord bent, abnormal	t10Tg + MO1-bcl2l16 + MO4-tp53	Fig. 3 from Prudent et al., 2013
notochord mislocalised laterally, abnormal	t10Tg + MO1-bcl2l16 + MO4-tp53	Fig. 3 from Prudent et al., 2013
pectoral fin morphology, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. S4 from Prudent et al., 2013
regulation of cytosolic calcium ion concentration disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 7 from Prudent et al., 2013
somite morphology, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. 3 from Prudent et al., 2013
somite filamentous actin deformed, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. S4 from Prudent et al., 2013
whole organism anterior-posterior axis shortened, abnormal	WT + MO1-bcl2l16 + MO4-tp53	Fig. S4 from Prudent et al., 2013

Phenotype of all Fish created by or utilizing MO1-bcl2l16

Phenotype	Fish	Conditions	Figures
actin polymerization or depolymerization process quality, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 5 from Prudent et al., 2013
pectoral fin morphology, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. S4 from Prudent et al., 2013
mesodermal cell filamentous actin oriented, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 5 from Prudent et al., 2013
somite morphology, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013
somite filamentous actin deformed, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. S4 from Prudent et al., 2013
regulation of cytosolic calcium ion concentration disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 7 from Prudent et al., 2013
anterior/posterior axis specification disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 4 from Prudent et al., 2013
whole organism anterior-posterior axis shortened, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. S4 from Prudent et al., 2013
embryo development disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013
mitochondrial calcium ion transmembrane transport disrupted, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 6 from Prudent et al., 2013
notochord bent, abnormal	WT + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013
notochord mislocalised laterally, abnormal	t10Tg + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013
notochord bent, abnormal	t10Tg + MO1-bcl2l16 + MO4-tp53	standard conditions	Fig. 3 from Prudent et al., 2013

Citations