Morpholino
MO2-zgc:100846
- ID
- ZDB-MRPHLNO-140617-2
- Name
- MO2-zgc:100846
- Previous Names
- Target
-
- zgc:100846 (1)
- Sequence
-
5' - ATTGTGGAGGACAGGCTGAAGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zgc:100846
No data available
Phenotype
Phenotype resulting from MO2-zgc:100846
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO2-zgc:100846
1 - 5 of 13 Show all
Citations
- de Calbiac, H., Renault, S., Haouy, G., Jung, V., Roger, K., Zhou, Q., Campanari, M.L., Chentout, L., Demy, D.L., Marian, A., Goudin, N., Edbauer, D., Guerrera, C., Ciura, S., Kabashi, E. (2024) Poly-GP accumulation due to C9orf72 loss of function induces motor neuron apoptosis through autophagy and mitophagy defects. Autophagy. 20:216421852164-2185
- Chaytow, H., Carroll, E., Gordon, D., Huang, Y.T., van der Hoorn, D., Smith, H.L., Becker, T., Becker, C.G., Faller, K.M.E., Talbot, K., Gillingwater, T.H. (2022) Targeting phosphoglycerate kinase 1 with terazosin improves motor neuron phenotypes in multiple models of amyotrophic lateral sclerosis. EBioMedicine. 83:104202
- Oprişoreanu, A.M., Smith, H.L., Krix, S., Chaytow, H., Carragher, N.O., Gillingwater, T.H., Becker, C.G., Becker, T. (2021) Automated in vivo drug screen in zebrafish identifies synapse-stabilising drugs with relevance to spinal muscular atrophy. Disease models & mechanisms. 14(4):
- Ciura, S., Lattante, S., Le Ber, I., Latouche, M., Tostivint, H., Brice, A., and Kabashi, E. (2013) Loss of function of C9orf72 causes motor deficits in a zebrafish model of Amyotrophic Lateral Sclerosis. Annals of neurology. 74(2):180-187
1 - 4 of 4
Show