Morpholino
MO1-bhlhe40
- ID
- ZDB-MRPHLNO-140605-1
- Name
- MO1-bhlhe40
- Previous Names
-
- dec1(E2I2)MO (1)
- Target
- Sequence
-
5' - AATTACGCATTCGTACCTTACTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bhlhe40
No data available
Phenotype
Phenotype resulting from MO1-bhlhe40
Phenotype | Fish | Figures |
---|---|---|
locomotor rhythm process quality, abnormal | WT + MO1-bhlhe40 |
Fig. 4
from Ben-Moshe et al., 2014 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-bhlhe40
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
locomotor rhythm process quality, abnormal | WT + MO1-bhlhe40 | standard conditions |
Fig. 4
from Ben-Moshe et al., 2014 |
1 - 1 of 1
Citations
- Nurcombe, Z.W., Hehr, C.L., McFarlane, S. (2023) Plexina4 and cell survival in the developing zebrafish hindbrain. Developmental Dynamics : an official publication of the American Association of Anatomists. 252(11):1323-1337
- Ben-Moshe, Z., Alon, S., Mracek, P., Faigenbloom, L., Tovin, A., Vatine, G.D., Eisenberg, E., Foulkes, N.S., and Gothilf, Y. (2014) The light-induced transcriptome of the zebrafish pineal gland reveals complex regulation of the circadian clockwork by light. Nucleic acids research. 42(6):3750-67
1 - 2 of 2
Show