Morpholino
MO1-ngfrb
- ID
- ZDB-MRPHLNO-140522-2
- Name
- MO1-ngfrb
- Previous Names
-
- p75 (1)
- Target
- Sequence
-
5' - AAGACGGTGGTCCTGGATGAAGTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ngfrb
No data available
Phenotype
Phenotype resulting from MO1-ngfrb
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-ngfrb
1 - 5 of 8 Show all
Citations
- Fédou, C., Lescat, O., Feuillet, G., Buléon, M., Neau, E., Breuil, B., Alvès, M., Batut, J., Blader, P., Decramer, S., Saulnier-Blache, J.S., Klein, J., Buffin-Meyer, B., Schanstra, J.P. (2020) The low affinity p75 neurotrophin receptor is down-regulated in congenital anomalies of the kidney and the urinary tract: Possible involvement in early nephrogenesis. Biochemical and Biophysical Research Communications. 533(4):786-791
- Han, H.W., Chou, C.M., Chu, C.Y., Cheng, C.H., Yang, C.H., Hung, C.C., Hwang, P.P., Lee, S.J., Liao, Y.F., and Huang, C.J. (2014) The Nogo-C2/Nogo receptor complex regulates the morphogenesis of zebrafish lateral line primordium through modulating the expression of dkk1b, a Wnt signal inhibitor. PLoS One. 9(1):e86345
1 - 2 of 2
Show