Morpholino
MO1-pax1b
- ID
- ZDB-MRPHLNO-140513-6
- Name
- MO1-pax1b
- Previous Names
- None
- Target
- Sequence
-
5' - CCCGTGTCTCCCGCTAAAGACTGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO, targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pax1b
No data available
Phenotype
Phenotype resulting from MO1-pax1b
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-pax1b
1 - 5 of 11 Show all
Citations
- Miao, D., Ren, J., Jia, Y., Jia, Y., Li, Y., Huang, H., Gao, R. (2024) PAX1 represses canonical Wnt signaling pathway and plays dual roles during endoderm differentiation. Cell communication and signaling : CCS. 22:242242
- Chen, X., Huang, H., Wang, H., Guo, F., Du, X., Ma, L., Zhao, L., Pan, Z., Gui, H., Yuan, T., Liu, X., Song, L., Wang, Y., He, J., Lei, H., Gao, R. (2014) Characterization of zebrafish pax1b and pax9 in fin bud development. BioMed Research International. 2014:309385
- Liu, X., Wang, H., Li, G., Huang, H.Z., and Wang, Y.Q. (2013) The function of DrPax1b gene in the embryonic development of zebrafish. Genes & genetic systems. 88(4):261-269
1 - 3 of 3
Show