Morpholino

MO3-casr

ID

ZDB-MRPHLNO-140501-1

Name

MO3-casr

Previous Names

None

Target

casr (1)

Sequence

5' - AGTTGGAACCTAATGTGGTCTTCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-casr

Expressed Gene	Anatomy	Figures
atp2b2	whole organism	Fig. 4 from Lin et al., 2014
fgf23	whole organism	Fig. 5 from Lin et al., 2017
pth1a	whole organism	Fig. 5 from Lin et al., 2014
slc8a1b	whole organism	Fig. 4 from Lin et al., 2014
stc1l	whole organism	Fig. 5 from Lin et al., 2017 Fig. 5, Fig. 6 from Lin et al., 2014
trpv6	whole organism	Fig. 4 from Lin et al., 2014

Phenotype

Phenotype resulting from MO3-casr

Phenotype	Fish	Figures
calcium ion homeostasis disrupted, abnormal	AB + MO3-casr	Fig. 4 from Lin et al., 2014
posterior lateral line neuromast basolateral plasma membrane ab1-casr labeling decreased amount, abnormal	AB + MO3-casr	Fig. 3 from Lin et al., 2018
posterior lateral line neuromast stereocilium ab1-casr labeling decreased amount, abnormal	AB + MO3-casr	Fig. 3 from Lin et al., 2018
whole organism stc1l expression decreased amount, abnormal	AB + MO3-casr	Fig. 5 from Lin et al., 2017

Phenotype of all Fish created by or utilizing MO3-casr

Phenotype	Fish	Conditions	Figures
posterior lateral line neuromast calcium ion import process quality, ameliorated	AB + MO3-casr	chemical treatment by environment: calcium channel agonist	Fig. 4 from Lin et al., 2018
posterior lateral line neuromast stereocilium ab1-casr labeling decreased amount, abnormal	AB + MO3-casr	control	Fig. 3 from Lin et al., 2018
whole organism stc1l expression decreased amount, abnormal	AB + MO3-casr	standard conditions	Fig. 5 from Lin et al., 2017
calcium ion homeostasis disrupted, abnormal	AB + MO3-casr	standard conditions	Fig. 4 from Lin et al., 2014
posterior lateral line neuromast basolateral plasma membrane ab1-casr labeling decreased amount, abnormal	AB + MO3-casr	control	Fig. 3 from Lin et al., 2018
posterior lateral line neuromast calcium ion import process quality, ameliorated	AB + MO3-casr	high calcium	Fig. 5 from Lin et al., 2018
whole organism fgf23 expression decreased amount, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal	AB + MO1-stc1l + MO3-casr	standard conditions	Fig. 8 from Lin et al., 2017
whole organism trpv6 expression increased amount, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017
whole organism fgf23 expression decreased amount, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017
calcium ion import increased occurrence, abnormal	AB + MO1-stc1l + MO3-casr	high calcium	Fig. 8 from Lin et al., 2017

Citations